birmaga.ru
добавить свой файл

1
ХАРАКТЕРИСТИКА БАКТЕРИЙ СЕМЕЙСТВА ANAPLASMATACEAE, ЦИРКУЛИРУЮЩИХ В ПРИРОДНЫХ ОЧАГАХ СВЕРДЛОВСКОЙ ОБЛАСТИ


Мухачева Т.А., Якушкина А.Ю.

Научный руководитель - к.б.н., Ковалев С.Ю.

Лаборатория молекулярной генетики, Уральский Государственный Университет им. А. М. Горького.
Введение

Свердловская область является эндемичным регионом по таким широко известным природноочаговым инфекциям, как клещевой энцефалит (КЭ) и иксодовый клещевой боррелиоз (ИКБ). Однако, наряду с возбудителями данных заболеваний клещи являются переносчиками различных бактерий, представляющих интерес для здравоохранения. С помощью молекулярно-генетических методов становится возможным обнаружение в клещах и характеристика всего комплекса микроорганизмов, включающего как инфекционных агентов (в том числе потенциальных), так и широкий круг симбионтов клещей. Так, на сегодняшний день показано широкое распространение в популяциях клещей в России бактерий семейства Anaplasmataceae – облигатных внутриклеточных паразитов. К ним относятся возбудители гранулоцитарного анаплазмоза человека (ГАЧ) и моноцитарного эрлихиоза человека (МЭЧ). Эрлихии и анаплазмы известны около ста лет как возбудители заболеваний животных, но их медицинская значимость выявлена относительно недавно. Вызываемые ими заболевания – яркий пример новых (возникающих) инфекций.

Исследования в отношении анаплазмозов и эрлихиозов человека в России были начаты только в конце 90-х годов ХХ века и к настоящему времени носят фрагментарный характер. Вместе с тем, выявление Ehrlichia muris и гранулоцитарных анаплазм в клещах Ixodes persulcatus в ряде регионов России, а также ретроспективная серологическая верификация диагнозов МЭЧ и ГАЧ в Уральском, Сибирском и Дальневосточном федеральном округах, свидетельствуют об актуальности этой проблемы в Российской Федерации.

Цель исследования – с помощью молекулярно-генетических методов охарактеризовать видовой состав и распространение бактерий семейства Anaplasmataceae в популяции клещей I.persulcatus в Свердловской области.


Материалы и методы исследования

Для детекции и последующего анализа комплекса бактерий семейства Anaplasmataceae была исследована выборка из 60 пулов и 30 одиночных клещей I.persulcatus, собранных в 2009-2010 гг. на территории Свердловской области. Суспензии клещей были любезно предоставлены ФГУЗ «Центром гигиены и эпидемиологии по Свердловской области». Число особей в каждом пуле варьировало от 2 до 10. Данные по зараженности одиночных клещей анализировались отдельно.

Выделение нуклеиновых кислот из суспензии гомогенизированных клещей производилось с помощью наборов «Рибо-сорб» и «Рибо-преп» для выделения РНК/ДНК (ООО «Интерлабсервис», Москва), согласно прилагаемой инструкции. Реакцию обратной транскрипции проводили с использованием набора «Реверта» (ООО «Интерлабсервис», Москва), согласно прилагаемой инструкции.

Детекцию бактерий – представителей семейства Anaplasmataceae проводили путем постановки ПЦР для амплификации участка гена 16S рРНК с последующим выборочным секвенированием. Реакцию амплификации проводили в амплификаторе «Терцик» («НПФ ДНК-технология», Москва). Продукты ПЦР разделяли с помощью электрофореза в 2% агарозном геле, окрашивали бромистым этидием и визуализировали с помощью ультрафиолетового трансиллюминатора с использованием видеосистемы Bio-TestDVI.22 (ООО «Компания «Биоком», Москва). Определение последовательностей фрагмента гена 16S рРНК бактерий проводили на секвенаторе ABI PRIZM® 310 Genetic Analyzer (Applied Biosystems, USA). Идентификацию последовательностей проводили путем сравнения с последовательностями в международной базе данных GenBank в программе BLAST (blast.ncbi.nlm.nih.gov).

Филогенетический анализ и выравнивание последовательностей ДНК проводили с помощью программы MEGA 4 [8].

С целью определения возможных случаев коинфицирования вышеуказанная выборка клещей была исследована также на предмет наличия боррелий. Установление наличия в пробе бактерий рода Borrelia производилось методом Real-Time PCR на амплификаторе ABI 7500 (Applied Biosystems, USA). Праймеры и зонды, используемые в работе, указаны в таблице 1.

Таблица 1. Праймеры, используемые для детекции в пробе боррелий и анаплазм.


Название праймера

Нуклеотидная последовательность

(5’-3’)

Амплифицируемый ген

Источник

16S-F

16S-R


16SBorrelia-Probe

GGTCAAGACTGACGCTGAGTCA

GGCGGCCACTTAACACGTTAG

R6G - TCTACGCTGTAAACGATGCACACTTGGTG-RTQ1

16S рРНК Borrelia

[5]

EHR16SD

EHR16SR

GGTACCYACAGAAGAAGTCC

TAGCACTCATCGTTTACAGC

16S рРНК Anaplasmataceae

[6]

Результаты исследования и их обсуждение

На протяжении последних десятилетий благодаря внедрению новых методов диагностики существенно расширился список инфекций, передающихся клещами. Так, в настоящее время клещи исследуются на присутствие вируса клещевого энцефалита, боррелий, анаплазм, эрлихий, риккетсий, бабезий, бартонелл, часть из которых может являться возбудителями инфекционных заболеваний человека [1]. Выявление столь широкого спектра микроорганизмов увеличивает встречаемость случаев сочетанных инфекций (коинфекций), что требует тщательного изучения вопросов взаимодействия патогенов между собой и влияния коинфицирования на ход заболевания.

Семейство Anaplasmataceae объединяет облигатные внутриклеточные бактерии родов Anaplasma, Ehrlichia, Neorickettsia, Wolbachia (они включают как патогенных для человека микроорганизмов, так и многочисленных симбионтов членистоногих). Для выяснения видового состава и распространенности представителей данного семейства нами была исследована выборка, состоящая из 60 пулов и 30 одиночных клещей I.persulcatus, собранных в разных районах области. Для детекции использовались универсальные праймеры для амплификации сегмента 16S рРНК. Зараженность клещей этими бактериями составила 53% (как в пулах, так и среди одиночных клещей). Выборочное определение нуклеотидных последовательностей позволило установить видовой состав микроорганизмов и оценить зараженность клещей отдельными видами. Территориальное распределение детектированных микроорганизмов показано на рисунке 1.


В Камышловском районе мы обнаружили возбудителя гранулоцитарного анаплазмоза человека (ГАЧ) - Anaplasma phagocytophilum (4,3%) . Обычные клинические проявления ГАЧ – лихорадка неясной этиологии, у больных также отмечают головные и мышечные боли, недомогание – комплекс, напоминающий синдром ОРВИ. Другие проявления наблюдают менее чем у половины больных – тошнота, рвота, боли в брюшной области, анорексия, диарея, боли в суставах, кашель. Тяжелые проявления ГАЧ включают септический синдром, синдром токсического шока, миокардит, различные неврологические нарушения, редко - менингиты и менингоэнцефалиты. [2]

A.phagocytophilum имеет широкий ареал и встречается в Северной Америке, Европе и Азии. Тяжесть и формы клинического проявления в различных частях нозоареала существенно отличаются. Исследования азиатской части России показывают относительно низкий процент зараженности клещей I.persulcatus данным патогеном – от 0,7 до 5,6% (в среднем 2,4%) [8]. Несмотря на то, что случаи ГАЧ на территории Европы регистрируются редко, специфические антитела распространены у людей довольно широко [2]. Таким образом, очевидно распространение возбудителя ГАЧ в России в пределах всего ареала клещей I.persulcatus, с возможными эпидемическими проявлениями очагов этой инфекции.


Рис.1. Территориальное распределение микроорганизмов семейства Anaplasmataceae на территории Свердловской области.

Моноцитарный эрлихиоз человека (МЭЧ) по своим клиническим проявлениям является более опасной инфекцией по сравнению с ГАЧ. Большинство случаев МЭЧ выявляют у больных с тяжелыми формами клинических проявлений и формами средней тяжести. У части больных наблюдают угрожающие жизни формы заболевания, близкие по клиническому проявлению синдрому токсического шока. Летальные исходы составляют от 2% до 7%. МЭЧ чаще (в сравнении с ГАЧ) проявляется менингоэнцефалитом, синдромом легочной недостаточности, острой почечной недостаточностью, сыпью [2]. На территории Свердловской области ни в одном случае нами не были детектированы ни возбудитель МЭЧ - Ehrlichia chaffeensis , ни возбудители эрлихиозов собак – E.canis и E. ewingii. Тем не менее, мы обнаружили близкий к Ehrlichia chaffeensis вид эрлихий - Ehrlichia muris. E.muris впервые была выделена от южно – азиатских полевок в Японии [2]. Эрлихии этого вида не были изолированы от больных МЭЧ, то есть вопрос об их патогенности до сих пор не решен. Тем не менее, близкое родство с возбудителем МЭЧ и способность E.muris вызывать заболевания у млекопитающих (мышей) позволяют рассматривать её как потенциального патогена. К настоящему времени установлено широкое распространение E.muris на территории России - от Прибалтики до Дальнего Востока [7]. В Свердловской области эта бактерия была обнаружена нами в нескольких исследуемых районах области (Рис.1). Зараженность одиночных клещей E.muris составила 27%.


Используя вышеуказанные праймеры, нам удалось амплифицировать последовательность 16S рРНК неклассифицированного микроорганизма «Montezuma», впервые выделенного на Дальнем Востоке от клещей и пациентов с лихорадочным синдромом после укуса клеща [4]. Филогенетический анализ показал, что данный организм формирует отдельную ветвь в порядке Rickettsiales и имеет наибольшую гомологию с эндосимбионтами Acantamoeba. По нашим данным, зараженность одиночных клещей I.persulcatus этой бактерией исключительно высока и составляет около 72%. Принимая во внимание данный факт, а также близкую связь «Montezuma» с внутриклеточными эндосимбионтами, возможно предположить симбиотический характер отношений этих микроорганизмов с клещами. Тем не менее, обнаружение их в клиническом материале показывает необходимость дальнейшего выяснения возможной инфекционности данного агента.

Ранее проведенные исследования показали наличие стабильного очага ИКБ на территории Свердловской области при зараженности клещей боррелиями порядка 50-70% [3]. Обнаруженные в ходе данной работы относительно высокие значения зараженности анаплазмами ставят закономерный вопрос о вероятности коинфицирования клещей этими группами бактерий. Оказалось, что 40% исследуемой выборки одиночных клещей содержали одновременно и боррелий, и анаплазм. Коинфицирование разными видами семейства Anaplasmataceae наблюдалось нами только в одном случае (E.muris + Montezuma).

Таким образом, было показано широкое распространение бактерий семейства Anaplasmataceae в клещах в Свердловской области, что предполагает их стабильную циркуляцию в природных очагах. В связи с потенциальным медицинским значением данных микроорганизмов лаборатория молекулярной генетики УрГУ планирует проведение систематических исследований распространения данной группы бактерий, а также особенностей их циркуляции в связи с существованием сочетанных природных очагов клещевых инфекций на территории области. Изучение этих вопросов позволит оценить эпидемиологическое значение анаплазм и разработать практические рекомендации по профилактике новых клещевых инфекций для врачей и служб эпидемиологического надзора.

Выводы:

1. На территории Свердловской области был детектирован возбудитель гранулоцитарного анаплазмоза человека – Anaplasma phagocytophilum.

2. Было установлено наличие в клещах I.persulcatus потенциального патогена человека Ehrlichia muris.

3. Впервые на территории Урала был детектирован неклассифицированный микроорганизм «Montezuma» и показана высокая зараженность им клещей I.persulcatus (около 72%).
ЛИТЕРАТУРА

1. Карань, Л. С. Применение ПЦР врежиме реального времени для диагностики различных клещевых инфекций // Журнал микробиологии. - 2010.- № 3.- С. 72-77.

2. Рудаков Н.В. Анаплазмозы и эрлихиозы человека – новая проблема инфекционной патологии в России: пособие для врачей // Омск, 2006 - 42с.

3. Якушкина А.Ю., Мухачева Т.А., Федотова А.А. Иксодовый клещевой боррелиоз на территории Свердловской области. Молекулярно-эпидемиологические особенности возбудителя. Материалы 65-й всероссийской научно-практической конференции молодых учёных и студентов с международным участием «Актуальные вопросы современной медицинской науки и здравоохранения», 2010. C. 452-455

4. Mediannikov, O. et al. Microorganism "Montezuma" of the order Rickettsiales: the potential causative agent of tick-borne disease in the Far East of Russia // Zh Mikrobiol Epidemiol Immunobiol. - 2004.- № 1.- p. 7-13.

5. Ornstein, K., Barbour, A. G. A reverse transcriptase-polymerase chain reaction assay of Borrelia burgdorferi 16S rRNA for highly sensitive quantification of pathogen load in a vector // Vector Borne Zoonotic Dis. - 2006.- № 1.- p. 103-112.

6. Parola, P. et al. Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and other eubacteria in ticks from the Thai-Myanmar border and Vietnam // J Clin Microbiol. - 2003.- № 4.- p. 1600-1608.

7. Rar V.A. et al. Genetic diversity of Anaplasma and Ehrlichia in the Asian part of Russia // Ticks and Tick-borne Diseases. - 2010.- № 1.- p. 57-65.


8. Tamura, K. et al. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0 // Molecular Biology and Evolution. - 2007.- № 8.- p. 1596-1599.

THE CHARACTERIZATION OF BACTERIA OF FAMILY ANAPLASMATACEAE CIRCULATING IN NATURAL FOCI AT SVERDLOVSKAYA REGION

Mukhacheva T. A, Yakushkina A.U.

Supervisor of studies – Dr. Kovalev S. Y.

Laboratory of molecular genetics of Ural State University.
The Summary. Ticks transmit many clinically important pathogens. Thus, the laboratory diagnosis of tick-born encephalitis (TBE) and Lyme borreliosis (LB) became almost routine. However, molecular genetics methods allow us to characterize not only well-known infectious agents, but also other bacteria transmitted by ticks, including microorganisms potentially important for the human health. We have examined a sampling of ticks for presence of intracellular bacteria of Anaplasmataceae family and detected 3 species – Anaplasma phagocytophilum (the agent of human granulocytic anaplasmosis), Ehrlichia muris (a bacteria closely related with Ehrlichia chaffeensis - agent of human monocytic ehrlichiosis) and unclassified Rickettsia-like microorganism «Montezuma». The last has been isolated firstly at Ural. 40% of the single ticks were found to be coinfected with Anaplasmataceae bacteria and Borrelia spp.

The complexity of microorganisms transmitted by ticks contributes to the complication of laboratory diagnosis of tick-transmitted infections and – in large scale – to the emergence of new infectious agents.

The Keywords: tick, Anaplasmataceae, molecular genetics